The distances of the gold grains relative to the NPC and NE midplane are presented in Figure 4B, along with a schematic drawing of the NPC in Figure 4A. Nup153 in various organisms (Cordes Tpr C-terminal domain name polypeptides. Rabbit affinity-purified polyclonal SCP3 antibodies were provided by Christer H??g (Karolinska Institutet, Stockholm, Sweden). Secondary antibodies coupled to horseradish peroxidase and fluorochromes were from DakoCytomation Denmark, and those coupled to 12 nm colloidal gold were from Jackson ImmunoResearch Laboratories (West Grove, PA). Fluorescent DNA probes used for in situ hybridization were from Thermo BioSciences (Ulm, Germany). The BR mRNA probe was a Cy3-coupled 30 oligomer (ACTTGGCTTGCTGTGTTTGCTTGGTTTGCT), the 18S rRNA probe was a Cy3-coupled 21 oligomer (TTTCAGTCCACAATCCCAACT), and the 28S rRNA probe was a Rotundine fluorescein isothiocyanate (FITC)-coupled 33 oligomer (CATTCGAATATTTGCTACTACCACCAAGATCTG). Antibody Purification and Concentration For microinjection and immunoelectron microscopic studies, hybridoma supernatant of the Nup153 antibody PF190 7A8 was concentrated and purified on a HiTrap Protein G affinity column (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom). Bound antibodies were eluted with 0.1 M glycine-HCl, pH 2.7, neutralized with 1 M Tris, pH 9.0, and further concentrated by ultrafiltration using a 50-kDa molecular weight Centriplus column (Millipore, Billerica, MA), with concomitant buffer exchange for phosphate-buffered saline (PBS). The final concentration of the purified antibody was 12 mg/ml. Western Blot Analysis of Nuclear Extracts Tissue culture cells were washed twice in cold PBS before disrupting the cells in TNM buffer (1 mM MgCl2 and 100 mM NaCl in 10 mM tetraethylammonium-HCl, pH 7.0) with 0.2% Nonidet P-40 and Complete protease inhibitor cocktail (Roche Diagnostics, Basel, Switzerland). The extract was homogenized and then centrifuged at 2000 and 4C for 10 min. The pellet made up of the nuclei Rotundine was resuspended in TNM buffer with protease inhibitors, sedimented by centrifugation again, and suspended in PBS and protease inhibitors. After brief sonication, the suspension was boiled in protein sample buffer. Proteins were separated by SDS-PAGE on 7.5% polyacrylamide gels and blotted onto Immobilon-P membranes (Millipore, Solna, Sweden) Blocking of filters and incubations with primary and secondary antibodies were performed essentially as described previously (Zhao C. tentans total nuclear extract from tissue culture cells by Western blot analysis (Physique 1). The antibody interacted specifically with a single band at 160 kDa, i.e., with a protein of comparable size as Nup153 from different vertebrate species. The same extract was probed with mAb414, an antibody known to recognize Nup153 and other nucleoporins in various organisms (Sukegawa and Blobel, 1993 ). One of the bands recognized by the antibody migrated in parallel with the one recognized by the anti-Nup153 antibody, strengthening the assumption that this Rotundine antibody specifically recognizes the Nup153 homologue. Open in a separate window Physique 1. Immunoblot analysis of nuclear extract from tissue culture cells using antibodies specific for Nup153 and other FG-repeat nucleoporins. Proteins separated by SDS-PAGE on neighboring lanes were probed with Nup153 mAb PF190 7A8 and mAb 414. Coomassie blue-stained nuclear extract proteins are shown as reference. Relative positions of molecular mass standards in kilodaltons are indicated to the left. The antibody was further tested by immunofluorescence microscopy on salivary glands. A nuclear rim was clearly seen, whereas the nucleoplasm was only faintly stained (Physique 2), with no apparent staining of the chromosomes or in the cytoplasm. Thus, the cellular distribution agrees with the one predicted for a Nup153 protein. Together, these results indicate that this antibody raised against rat-Nup153 also recognizes a homologue of Nup153. Open in a separate window Physique 2. Immunofluorescence Rabbit Polyclonal to GPR124 microscopy of salivary gland cells using anti-Nup153 and FITC-coupled secondary antibodies. A mAb against human factor VIII was used as unfavorable control. The chromosomes are stained with SYTOX orange nucleic acid stain. Bar, 20 m. Nup153 Is Located around the Nuclear Side of the NPC Core A closer look at the distribution of Nup153 was performed by immunoelectron microscopy on sections of larval salivary glands. We adopted a recently described postembedding approach (Krull Nup153 is usually predominantly located at the NE. Open in a separate window Physique 3. Localization of Nup153 and Tpr at the nuclear pore complex by postembedding immunoelectron microscopy. Primary antibodies (anti-Nup153 or anti-Tpr) were visualized with secondary antibodies coupled to colloidal gold. Immunolabeling with anti-Nup153 (A, C, and D) and with anti-Tpr (E and F). A segment of the NE as well as adjacent regions of nucleoplasm (Npl) and cytoplasm (Cpl) are displayed in A. Two large BR particles are bound to the nuclear side of the NE (left), and one particle has started to translocate through the nuclear pore (right). Gold particles at the NE are marked by arrows. In BCF, micrographs of single NPCs are presented. Corresponding schematic drawings are shown below. The core of the NPC is usually depicted in gray and the approximate position of the nuclear basket has been demarcated by broken lines. In B, a representative NPC is usually displayed in which the electron-dense NPC core, the flanking double membranes of the NE, and fibrous.